Skip to main content

Table 2 Primer sequences for RT-qPCR

From: The critical role of m6A methylation in the pathogenesis of Graves' ophthalmopathy

Gene Forward Primer (5′ - 3′) Reverse Primer (5′ - 3′)
WTAP TTGTAATGCGACTAGCAACCAA GCTGGGTCTACCATTGTTGATCT
METTL3 AGATGGGGTAGAAAGCCTCCT TGGTCAGCATAGGTTACAAGAGT
METTL14 GAACACAGAGCTTAAATCCCCA TGTCAGCTAAACCTACATCCCTG
FTO AACACCAGGCTCTTTACGGTC TGTCCGTTGTAGGATGAACCC
ALKBH5 AGTTCCAGTTCAAGCCTATTCG TGAGCACAGTCACGCTTCC
HNRNPA2B1 ATTGATGGGAGAGTAGTTGAGCC AATTCCGCCAACAAACAGCTT
ELF3 GGCCGATGACTTGGTACTGAC GCTTGCGTCGTACTTGTTCTTC
YTHDF1 ATACCTCACCACCTACGGACA GTGCTGATAGATGTTGTTCCCC
YTHDF2 GTTGGTAGCGGGTCCATTACT GGTCTTCAGTTTAGGTTGCTGT
YTHDF3 TCAGAGTAACAGCTATCCACCA GGTTGTCAGATATGGCATAGGCT
YTHDC1 AACTGGTTTCTAAGCCACTGAGC GGAGGCACTACTTGATAGACGA
YTHDC2 GGTATCCCCTGCCGTATATTTTG CTTTCCCGTCTCTCTGCGG
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG