Skip to main content

Table 1 Expression primers

From: The anti-scarring effect of corneal stromal stem cell therapy is mediated by transforming growth factor β3

  Gene GeneBank Accession No. Sequences
Oligonucleotide primers
 1 hTGFβ1 NM_000660.7 F: GACTGCGGATCTCTGTGTCATT
R: CAGTAGTGTTCCCCACTGGTC
 2 hTGFβ3 NM_003239.4 F: CTTCCAGATCCTTCGGCCAG
R: ATCAAAGGACAGCCACTCGG
 3 hTSG6 NM_007115.4 F: AAGGATGGGGATTCAAGGAT
R: GCTTGTATTTGCCAGACCGT
 4 mARG1 NM_031508.1 F: GATTATCGGAGCGCCTTTCT
R: CCACACTGACTCTTCCATTCTT
 5 mCol3a1 NM_009930.2 F: CGTAAGCACTGGTGGACAGA
R: CGGCTGGAAAGAAGTCTGAG
 6 mFN1 NM010233.2 F: TACTCGAGCCCTGAGGATGG
R: GCAAGGCAACCACACTGACT
 7 mHAS2 BC080281 F: CCAAGGTTCTGCTTCCTCAC
R: CTCTCCATACGGGGAGAGTC
 8 miNOS NM_001313922.1 F: TCACCTTCGAGGGCAGCCGA
R: TCCGTGGCAAAGCGAGCCAG
 9 mSPARC XM_030245730.1 F: ATGAGGGCCTGGATCTTCTT
R: CACGGTTTCCTCCTCCACTA
 10 mSMA NM_009696.3 F: TGTGCTGGACTCTGGAGATG
R: GAAGGAATAGCCACGCTCAG
 11 mTNC NM_035737.2 F: GACTGCCCTGGGAACTGTAA
R: CATAGCCTTCGAAGCACACA
TaqMan assay IDs
 7 hTGFβ1 NM_000660.7 Hs99999918_m1
 8 hTGFβ3 NM_003239.4 Hs04398989_m1
 9 hGAPDH NM_001256799.3 Hs01120607_g1
 10 mCD80 NM_009855.2 Mm00711660_m1
 11 mLcn2 NM_032517.1 Mm01324470_m1
 12 mPLAU NM_032899.1 Mm01149438_m1
 13 mPpbp NM_023785.3 Mm00470163_m1
 14 mSpp1 NM_001204203 Mm00436767_m1
 15 mG6pdx NM_032034.3 Mm00656735_g1
  1. h = human; m = mouse